Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 26868025 26879685 enh18368

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 26873298 rs370161250 T TGGAAGGAGGCCAGCATGGC 5600057
chr2 26873298 rs546797212 T TGGAAGGAGGCCAGCATGGC 5600058

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results