EnhancerDB
  1. Home
  2. TFBS
  3. NFIA[chr2:36653301-36653311]
Chromosome characteristics of NFIA[chr2:36653301-36653311]
Back to top
Enhancers possibly regulated by NFIA[chr2:36653301-36653311]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 36653045 36668315 enh62775
Prostate (PC-3) Cervix (HeLa-S3) Epithelial (MCF-7) Prostate (RWPE1) Lung (PC-9) Esophagus Bone (Osteoblast) Stomach Colon (HCT116) Uterus Muscle (Myoblast) Breast Pancreas (Panc1) Neural Stem Cells (H9) Heart
SNP sites on NFIA[chr2:36653301-36653311]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 36653310 rs144614667 A G 5645978
chr2 36653311 rs563779333 TAGATTGAATCTCTGAAATGCATAGTCC T 5645979
Genes possibly regulated by NFIA[chr2:36653301-36653311]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NFIA[chr2:36653301-36653311]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results