EnhancerDB
  1. Home
  2. TFBS
  3. SOX8[chr2:36675772-36675788]
Chromosome characteristics of SOX8[chr2:36675772-36675788]
Back to top
Enhancers possibly regulated by SOX8[chr2:36675772-36675788]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 36674469 36691355 enh18440
Bone Marrow (K562) Brain (SK-N-MC) Liver Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Stomach Ovary Pancreas (Panc1) Neural Stem Cells (H9) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Spleen Liver (HepG2) Prostate (RWPE1) Muscle (A673) Heart
SNP sites on SOX8[chr2:36675772-36675788]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 36675775 rs201240067 C CTT 5646210
chr2 36675787 rs3836080 T TTATTAAGATGAATGAACTTACCA 5646211
chr2 36675787 rs60637297 T TTATTAAGATGAATGAACTTACCA 5646212
Genes possibly regulated by SOX8[chr2:36675772-36675788]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SOX8[chr2:36675772-36675788]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results