Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 36675787 rs3836080 T TTATTAAGATGAATGAACTTACCA 5646211
chr2 36675787 rs60637297 T TTATTAAGATGAATGAACTTACCA 5646212

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results