Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 70195265 70239804 enh5637
chr2 70226418 70226806 vista31986

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 70226692 rs72202052 GCAGGATAATCACTTGAACA G 5832591

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results