Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 238060730 238076822 enh19385

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 238071825 rs373562686 TCTGCTCCATCAGCAATATTTATATTTA T 6477069
chr2 238071825 rs72371575 TCTGCTCCATCAGCAATATTTATATTTA T 6477070

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results