Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 92498985 92505878 enh57620
chr12 92505299 92505700 vista14388

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 92505603 rs145489195 G GTAGAGGATGGCTTGAACCTAGGAAC 2801474

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results