| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr9 | 110807597 | 110825949 | enh25873 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr9 | 110811312 | rs55975335 | GAAAACAAAGTATTAATGAATAATAATATCT | G | 11211593 | |
| chr9 | 110811312 | rs796273736 | GAAAACAAAGTATTAATGAATAATAATATCT | G | 11211594 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|