Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 111534469 111552493 enh42172

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 111546745 rs141033690 ACTCTCCCACCTTTGCCAGAGC A 11217060
chr9 111546745 rs72357885 ACTCTCCCACCTTTGCCAGAGC A 11217061

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results