Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 189807981 189821775 enh21216

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 189811777 rs11270299 AAAAAGTGGTGCTATGTAGCT A 7287961
chr3 189811777 rs569659029 AAAAAGTGGTGCTATGTAGCT A 7287962

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results