EnhancerDB
  1. Home
  2. TFBS
  3. REST[chr4:7893107-7893128]
Chromosome characteristics of REST[chr4:7893107-7893128]
Back to top
Enhancers possibly regulated by REST[chr4:7893107-7893128]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 7872045 7899128 enh21351
Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-MC) Prostate (RWPE1) Brain (SK-N-SH) Esophagus Astrocyte Bone (Osteoblast) Stomach Muscle (A673) Placenta Colon (HCT116) Uterus Lung (PC-9) Muscle (Myoblast) Pancreas (Panc1) Neural Stem Cells (H9) Blood (T-cell) Epithelial (MCF-7)
SNP sites on REST[chr4:7893107-7893128]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 7893111 rs541501589 A AGGACCAGAGAGAAAACCTAACTGGTCAAG 7391780
chr4 7893113 rs548765312 G A 7391781
chr4 7893118 rs182610545 G A 7391782
Genes possibly regulated by REST[chr4:7893107-7893128]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by REST[chr4:7893107-7893128]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results