EnhancerDB
  1. Home
  2. TFBS
  3. RREB1[chr4:7978384-7978404]
Chromosome characteristics of RREB1[chr4:7978384-7978404]
Back to top
Enhancers possibly regulated by RREB1[chr4:7978384-7978404]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 7955942 7984080 enh21353
Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Bone (Osteoblast) Thyroid Pancreas (Panc1) Neural Stem Cells (H9) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Spleen Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on RREB1[chr4:7978384-7978404]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 7978389 rs367585480 AACACATGCACACACACACATGTGCATGCAC A 7393002
chr4 7978389 rs543037163 AACACATGCACACACACACATGTGCATGCAC A 7393003
chr4 7978401 rs528226972 C T 7393004
Genes possibly regulated by RREB1[chr4:7978384-7978404]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RREB1[chr4:7978384-7978404]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results