EnhancerDB
  1. Home
  2. TFBS
  3. MEF2A[chr4:111005091-111005101]
Chromosome characteristics of MEF2A[chr4:111005091-111005101]
Back to top
Enhancers possibly regulated by MEF2A[chr4:111005091-111005101]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 111004285 111013803 enh36923
Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Brain (SK-N-MC) Large Intestine Prostate (RWPE1) Lung (PC-9) Astrocyte Blood (OCI-LY7) Muscle (A673) Colon (HCT116) Peripheral Blood (MM.1S) Muscle (Myoblast) Pancreas Spleen Neural Stem Cells (H9) Stomach
SNP sites on MEF2A[chr4:111005091-111005101]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 111005095 rs538030502 T C 7746327
chr4 111005095 rs576724256 TATATAACATGTTATATATGATATATATG T 7746328
Genes possibly regulated by MEF2A[chr4:111005091-111005101]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by MEF2A[chr4:111005091-111005101]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results