Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 148407805 148416195 enh37169

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 148414504 rs140177461 GTATTTCTATAGGGTAGTCTTA G 7870051

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results