Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 10589105 10610795 enh69043

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 10607220 rs376680804 CTTCCCAAAGTGCTGGTTTTACAGGCATGAGCCACCGCACTTGA C 4307904

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results