Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 22079774 22086763 enh58700

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 22085567 rs576363377 ATGTCTTTTTTATTTTTGTGTTCATAT A 4370394

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results