EnhancerDB
  1. Home
  2. TFBS
  3. RREB1[chr6:11319850-11319870]
Chromosome characteristics of RREB1[chr6:11319850-11319870]
Back to top
Enhancers possibly regulated by RREB1[chr6:11319850-11319870]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 11314009 11328675 enh23020
Astrocyte Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Ovary Bone (Osteoblast) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myoblast) Breast Spleen Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung
SNP sites on RREB1[chr6:11319850-11319870]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 11319850 rs555203568 TCA T 8829727
chr6 11319852 rs33999916 A ACG,ATG,ATGCACACTCACACACTAACATGCAGACACACACACTAACATG 8829728
chr6 11319854 rs9380203 A G 8829729
chr6 11319858 rs111161975 A T 8829730
chr6 11319860 rs200455858 A T 8829731
Genes possibly regulated by RREB1[chr6:11319850-11319870]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RREB1[chr6:11319850-11319870]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results