EnhancerDB

Chrom.	Start	End	Enhancer ID	TSS of gene	Distance between enhancer and TSS	Tissues that enhancer appears
chr5	13933725	13937875	enh97621	13944652	6777	Epithelial (MCF-7)
chr5	13960725	13964875	enh97622	13944652	16073	Epithelial (MCF-7)
chr5	13975099	13979231	enh116220	13944652	30447	Pancreas (Panc1)
chr5	13983680	13991355	enh37618	13944652	39028	Prostate (PC-3) Astrocyte Bone (Osteoblast) Lung (PC-9) Muscle (Myoblast) Pancreas (Panc1) Muscle (Myotube) Epithelial (MCF-7)
chr5	14007145	14014252	enh63387	13944652	62493	Liver (HepG2) Cervix (HeLa-S3) Esophagus Bone (Osteoblast) Uterus Epithelial (MCF-7)
chr5	14011107	14011342	vista47075	13944652	66455	VISTA
chr5	14024025	14042149	enh8386	13944652	79373	Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Epithelial (MCF-7) Cervix (HeLa-S3) Prostate (RWPE1) Lung (PC-9) Esophagus Astrocyte Bone (Osteoblast) Stomach Colon (HCT116) Breast Blood (Karpas-422) Muscle (Myoblast) Pancreas Uterus Heart
chr5	14034644	14034850	vista47076	13944652	89992	VISTA
chr5	14035955	14036534	vista47077	13944652	91303	VISTA
chr5	14036813	14036909	vista47078	13944652	92161	VISTA
chr5	14037218	14037324	vista47079	13944652	92566	VISTA
chr5	14037561	14037744	vista47080	13944652	92909	VISTA
chr5	14038478	14038912	vista47081	13944652	93826	VISTA
chr5	14039774	14040034	vista47082	13944652	95122	VISTA

Chrom.	Start	End	TF name	Source	Predicted site?	Tissue	TSS of gene	Distance between TFBS and gene	id	More

Chrom.	Position	dbSNP ID	Reference Allele	Alternative Allele	Distance between TSS and SNP	Tissue	q Value	id
chr5	14013407	rs2582689	A	G	68755	Esophagus	0.0351647	8094329
chr5	14009923	rs429898	T	C	65271	Esophagus	2.13942e-30	8094280
chr5	14011654	rs10069228	C	A	67002	Breast	6.79515e-05	8094304
chr5	14012046	rs366131	T	C	67394	Spleen	0.00151295	8094312
chr5	14008400	rs750459056	T	TGAGGGAGGGAGGGAAGGAGGAGGGGATG	63748	Thyroid	5.15774e-42	8094259
chr5	14010231	rs10073221	T	G	65579	Lung	1.24433e-23	8094283
chr5	13995121	rs2662625	C	G	50469	Adrenal	2.51853e-09	8094233