EnhancerDB

Chrom.	Start	End	Enhancer ID	TSS of gene	Distance between enhancer and TSS	Tissues that enhancer appears
chr6	38983974	38988124	enh66205	39082965	94841	Heart
chr6	39005999	39010551	enh87388	39082965	72414	Blood (GM12878)
chr6	39019785	39023935	enh101985	39082965	59030	Thyroid
chr6	39026553	39032942	enh66206	39082965	50023	Heart
chr6	39041677	39046023	enh87389	39082965	36942	Blood (GM12878)
chr6	39044717	39045064	vista51850	39082965	37901	VISTA
chr6	39061184	39061194	vista51851	39082965	21771	VISTA
chr6	39109405	39113555	enh108063	39082965	26440	Blood (T-cell)
chr6	39119625	39124035	enh49096	39082965	36660	Thymus
chr6	39122561	39122673	vista51852	39082965	39596	VISTA
chr6	39132265	39141535	enh23213	39082965	49300	Prostate (PC-3) Ovary Large Intestine Stomach Placenta Lung (PC-9) Pancreas Epithelial (MCF-7)
chr6	39144205	39156265	enh23214	39082965	61240	Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Large Intestine Placenta Thyroid Lung (PC-9) Uterus Stomach
chr6	39165525	39196155	enh23215	39082965	82560	Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Blood (T-cell) Liver Blood (GM12878) Stomach Placenta Colon (HCT116) Thyroid Embryonic Stem Cell Line (H1-hESC) Lung (PC-9) Pancreas Neural Stem Cells (H9) Thymus Epithelial (MCF-7)
chr6	39171657	39171958	vista51853	39082965	88692	VISTA

Chrom.	Start	End	TF name	Source	Predicted site?	Tissue	TSS of gene	Distance between TFBS and gene	id	More

Chrom.	Position	dbSNP ID	Reference Allele	Alternative Allele	Distance between TSS and SNP	Tissue	q Value	id
chr6	39189379	rs2815117	C	T	106414	Heart	0.244275	9011172
chr6	39440657	rs149160797	ATGGAGTTTCACTCTTGCTGCCCAGGC	A	357692	Ovary	0.376575	9013196
chr6	38218109	rs78596997	C	A	853731	Thyroid	0.0670055	9007275

Genomic Location	chr6:39071840-39082965[-]
TSS	39082965
Gene Name	SAYSD1
Ensembl ID	ENSG00000112167.5
ENTREZID	55776
Uniprot
Uniprot	Q9NPB0
Protein Name
Protein Name	SAYSvFN domain-containing protein 1