EnhancerDB
  1. Home
  2. Gene
  3. LRRC29[ENSG00000125122.10]
Enhancers that regulate LRRC29[ENSG00000125122.10]
Back to top
Chrom. Start End Enhancer ID TSS of gene Distance between enhancer and TSS Tissues that enhancer appears More
chr16 67186810 67187094 vista22780 67260951 73857
VISTA
chr16 67201685 67209895 enh16732 67260951 51056
Placenta Uterus Cervix (HeLa-S3)
chr16 67244825 67253395 enh16733 67260951 7556
Bone Marrow (K562) Cervix (HeLa-S3) Brain (SK-N-SH) Lung Placenta Lung (PC-9) Pancreas Spleen Heart
chr16 67250789 67251131 vista22781 67260951 9820
VISTA
chr16 67272406 67280555 enh4090 67260951 11455
Bone Marrow (K562) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Large Intestine Blood (T-cell) Astrocyte Bone (Osteoblast) Lung Muscle (A673) Colon (HCT116) Uterus Blood (Karpas-422) Neural Stem Cells (H9) Thymus Heart
chr16 67278264 67278626 vista22782 67260951 17313
VISTA
chr16 67278684 67278969 vista22783 67260951 17733
VISTA
chr16 67300225 67304439 enh31885 67260951 39274
Bone Marrow (K562) Cervix (HeLa-S3) Prostate (RWPE1) Large Intestine Astrocyte Bone (Osteoblast) Lung (PC-9)
chr16 67343410 67348895 enh16734 67260951 82459
Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Astrocyte Bone (Osteoblast) Placenta Colon (HCT116) Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Uterus Epithelial (MCF-7)
chr16 67345616 67346198 vista22784 67260951 84665
VISTA
Transcript facotrs that regulate LRRC29[ENSG00000125122.10]
Back to top
Chrom. Start End TF name Source Predicted site? Tissue TSS of gene Distance between TFBS and gene id More
SNPs associated with LRRC29[ENSG00000125122.10], confirmed by eQTL
Back to top
Chrom. Position dbSNP ID Reference Allele Alternative Allele Distance between TSS and SNP Tissue q Value id More
chr16 67016836 rs60631781 C A 224206 Esophagus 0.231036 4494901
chr16 67213923 rs13339140 C T 27119 Heart 0.00487018 4495521
chr16 67212032 rs374352035 GAGCCCCGCCCCTCGCCCGA G 29010 Heart 0.0713218 4495508
chr16 66331993 rs147664733 T C 909049 Breast 0.0115943 4491754
chr16 68177036 rs76495028 G C 916085 Uterus 0.285522 4499398
Details of LRRC29[ENSG00000125122.10]
Back to top
Genomic Location chr16:67241042-67260951[-]
TSS 67260951
Gene Name LRRC29
Ensembl ID ENSG00000125122.10
ENTREZID 26231
Uniprot
Q8WV35
A0A024R6W8
Protein Name
isoform CRA_a
Leucine rich repeat containing 29
Leucine-rich repeat-containing protein 29
Expression levels of LRRC29[ENSG00000125122.10]
Back to top