EnhancerDB
  1. Home
  2. Gene
  3. ZNF490[ENSG00000188033.5]
Enhancers that regulate ZNF490[ENSG00000188033.5]
Back to top
Chrom. Start End Enhancer ID TSS of gene Distance between enhancer and TSS Tissues that enhancer appears More
chr19 12652705 12658275 enh32888 12750912 92637
Bone Marrow (K562) Liver (HepG2) Esophagus Astrocyte Stomach Heart
chr19 12672985 12677135 enh99540 12750912 73777
Uterus
chr19 12682702 12690335 enh5011 12750912 60577
Blood (T-cell) Blood (OCI-LY7) Placenta Peripheral Blood (MM.1S) Blood (Karpas-422) Spleen Thymus
chr19 12717685 12730695 enh5012 12750912 20217
Esophagus Thyroid Blood (Karpas-422)
chr19 12724614 12724901 vista28647 12750912 26011
VISTA
chr19 12844296 12844608 vista28648 12750912 93384
VISTA
Transcript facotrs that regulate ZNF490[ENSG00000188033.5]
Back to top
Chrom. Start End TF name Source Predicted site? Tissue TSS of gene Distance between TFBS and gene id More
SNPs associated with ZNF490[ENSG00000188033.5], confirmed by eQTL
Back to top
Chrom. Position dbSNP ID Reference Allele Alternative Allele Distance between TSS and SNP Tissue q Value id More
chr19 12688321 rs370268434 AAATGTTCCTGGTGAGAGAAGCG A 454 Esophagus 0.00196809 5445957
chr19 12684559 rs8112261 C T 4216 Breast 0.0486872 5445929
chr19 12684825 rs4239551 C G 3950 Thyroid 8.2414e-08 5445932
chr19 13322848 rs60185051 T C,G 571936 Lung 0.281773 5449592
Details of ZNF490[ENSG00000188033.5]
Back to top
Genomic Location chr19:12688775-12750912[-]
TSS 12750912
Gene Name ZNF490
Ensembl ID ENSG00000188033.5
ENTREZID 57474
Uniprot
Q9ULM2
Protein Name
Zinc finger protein 490
Expression levels of ZNF490[ENSG00000188033.5]
Back to top