EnhancerDB
  1. Home
  2. TFBS
  3. INSM1[chr6:43064688-43064700]
Chromosome characteristics of INSM1[chr6:43064688-43064700]
Back to top
Enhancers possibly regulated by INSM1[chr6:43064688-43064700]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 43045645 43067063 enh23249
Brain (SK-N-MC) Astrocyte Colon (HCT116) Embryonic Stem Cell Line (H1-hESC) Uterus Stomach Epithelial (MCF-7) Skin (Keratinocyte) Bone (Osteoblast) Thyroid Neural Stem Cells (H9) Thymus Prostate (PC-3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Breast Liver (HepG2) Prostate (RWPE1) Muscle (A673)
SNP sites on INSM1[chr6:43064688-43064700]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 43064695 rs150253030 G GGGCCGTGGAGAGCAAGGGAGCAGCTCATTCAAA 9035829
chr6 43064695 rs55807201 G GGGCCGTGGAGAGCAAGGGAGCAGCTCATTCAAA 9035830
Genes possibly regulated by INSM1[chr6:43064688-43064700]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by INSM1[chr6:43064688-43064700]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results