Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 29150646 29173335 enh16623
chr16 29166546 29166864 vista22320

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 29166621 rs537570515 GGCCGGGGACACGTGAGAGCTGGGGTCATGTGAGA G 4402061

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results