EnhancerDB
  1. Home
  2. TFBS
  3. POLR2A[chr1:156074845-156076787]
Chromosome characteristics of POLR2A[chr1:156074845-156076787]
Back to top
Enhancers possibly regulated by POLR2A[chr1:156074845-156076787]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 156063928 156076316 enh12294
Liver Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Stomach Skin (Keratinocyte) Bone (Osteoblast) Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Breast Muscle (Myoblast) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
chr1 156072303 156076849 vista105
VISTA
chr1 156074715 156075305 vista3446
VISTA
SNP sites on POLR2A[chr1:156074845-156076787]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 156074845 rs6661281 T C 646849
chr1 156074852 rs182945027 C T 646850
chr1 156074869 rs188605076 A C,G 646851
chr1 156074933 rs142609801 G T 646852
chr1 156075182 rs146911556 C A,T 646853
chr1 156075194 rs76042463 C CCT 646854
chr1 156075230 rs573102211 G A 646855
chr1 156075251 rs373213057 C T 646856
chr1 156075254 rs558850361 G A 646857
chr1 156075255 rs576909759 C G 646858
chr1 156075266 rs372535219 TCTC T 646859
chr1 156075266 rs574843355 TCTC T 646860
chr1 156075483 rs560731031 G A 646861
chr1 156075558 rs79029071 C T 646862
chr1 156075595 rs76462222 T C 646863
chr1 156075650 rs568245502 C T 646864
chr1 156075871 rs138377811 A G 646865
chr1 156075902 rs566667716 G A 646866
chr1 156076230 rs397842727 CAG C 646867
chr1 156076230 rs4020356 CAG C 646868
chr1 156076244 rs79967459 C T 646869
chr1 156076366 rs368894409 C T 646870
chr1 156076408 rs11268414 ACCCACGCCTCTGTCCCCACCCC A 646871
chr1 156076408 rs199730525 ACCCACGCCTCTGTCCCCACCCC A 646872
chr1 156076460 rs545955390 C A 646873
Genes possibly regulated by POLR2A[chr1:156074845-156076787]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by POLR2A[chr1:156074845-156076787]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results