Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 202003987 rs6694034 A C 859134
chr1 202004069 rs114473276 G A,T 859135
chr1 202004111 rs192923589 G A 859136
chr1 202004204 rs4434889 G C 859137
chr1 202004233 rs183911587 G C 859138
chr1 202004254 rs11267336 A ATGGTCACATACCTAAGTATGTG 859139
chr1 202004356 rs116756971 A G 859140
chr1 202004365 rs139313090 A G 859141
chr1 202004405 rs79307954 G A 859142

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results