Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 212457845 rs184197889 C A 922210
chr1 212457885 rs139905916 A G 922211
chr1 212457974 rs542933487 AGTAGCTCTCTGGAGTTGCG A 922212
chr1 212457987 rs72752376 A G 922213
chr1 212458011 rs568326352 G C 922214
chr1 212458049 rs72752377 T C,G 922215

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 212458879 212535200 + PPP2R5A ENSG00000066027.7 212458879 0.76 0.99 757 1825


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results