EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr1:228074986-228076838]
Chromosome characteristics of ZBTB33[chr1:228074986-228076838]
Back to top
Enhancers possibly regulated by ZBTB33[chr1:228074986-228076838]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 228069592 228093895 enh12737
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Blood (T-cell) Lung Stomach Placenta Breast Embryonic Stem Cell Line (H1-hESC) Pancreas Muscle (Myotube) Uterus Thymus Epithelial (MCF-7)
chr1 228074836 228075224 vista5403
VISTA
SNP sites on ZBTB33[chr1:228074986-228076838]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 228075054 rs541156924 T C 999633
chr1 228075059 rs183926287 C G,T 999634
chr1 228075060 rs574560034 C A,G,T 999635
chr1 228075183 rs74143705 G A 999636
chr1 228075187 rs561453813 T C 999637
chr1 228075263 rs568176055 G A 999638
chr1 228075427 rs138629811 G A 999639
chr1 228075474 rs577440670 G T 999640
chr1 228075492 rs534904246 G C 999641
chr1 228075647 rs4233230 G T 999642
chr1 228075694 rs76585696 C G 999643
chr1 228075820 rs201046167 A AG 999644
chr1 228075915 rs564424712 G A 999645
chr1 228075985 rs528358334 G A 999646
chr1 228076081 rs74143706 G A 999647
chr1 228076087 rs545995439 A C 999648
chr1 228076141 rs115608820 T C 999649
chr1 228076164 rs568788051 T C 999650
chr1 228076355 rs117424967 G A 999651
chr1 228076498 rs116929961 A C 999652
chr1 228076603 rs375569713 GCCAGGCATGCATGGCTCAGGTGTCCACGGC G 999653
chr1 228076603 rs575862390 GCCAGGCATGCATGGCTCAGGTGTCCACGGC G 999654
chr1 228076609 rs546193892 C T 999655
chr1 228076615 rs191891984 T A 999656
chr1 228076619 rs573222486 T C 999657
chr1 228076623 rs540525416 G A 999658
chr1 228076631 rs561898308 G A 999659
chr1 228076632 rs529077279 G A 999660
chr1 228076633 rs544051024 C G,T 999661
chr1 228076637 rs116152022 G A 999662
chr1 228076739 rs878811 T C 999663
Genes possibly regulated by ZBTB33[chr1:228074986-228076838]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr1:228074986-228076838]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results