EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr10:95198602-95198978]
Chromosome characteristics of ZNF143[chr10:95198602-95198978]
Back to top
Enhancers possibly regulated by ZNF143[chr10:95198602-95198978]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 95190385 95209175 enh13411
Brain (SK-N-MC) Astrocyte Colon (HCT116) Pancreas Uterus Epithelial (MCF-7) Kidney Skin (Keratinocyte) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Spleen Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
chr10 95198614 95198817 vista8356
VISTA
SNP sites on ZNF143[chr10:95198602-95198978]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 95198635 rs532573969 C A 1586525
chr10 95198886 rs77847877 C G 1586526
chr10 95198927 rs369304997 TGGTATCACTGTTACCTTTGCA T 1586527
chr10 95198927 rs572689525 TGGTATCACTGTTACCTTTGCA T 1586528
chr10 95198932 rs568592847 T A 1586529
Genes possibly regulated by ZNF143[chr10:95198602-95198978]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr10:95198602-95198978]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results