EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr11:128420047-128422148]
Chromosome characteristics of ZBTB33[chr11:128420047-128422148]
Back to top
Enhancers possibly regulated by ZBTB33[chr11:128420047-128422148]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 128412401 128441450 enh2106
Blood (T-cell) Esophagus Bone (Osteoblast) Lung Blood (OCI-LY7) Blood (GM12878) Stomach Placenta Thyroid Uterus Peripheral Blood (MM.1S) Blood (Karpas-422) Muscle (Myoblast) Breast Muscle (Myotube) Neural Stem Cells (H9) Thymus Heart
chr11 128420960 128421096 vista12097
VISTA
chr11 128421542 128421887 vista12098
VISTA
SNP sites on ZBTB33[chr11:128420047-128422148]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 128420199 rs11221344 C G 2357787
chr11 128420236 rs151235362 G C 2357788
chr11 128420297 rs141553693 C T 2357789
chr11 128420304 rs145412347 T C 2357790
chr11 128420362 rs147699246 C T 2357791
chr11 128420395 rs192001755 T G 2357792
chr11 128420412 rs74531662 G C 2357793
chr11 128420479 rs11221346 G A 2357794
chr11 128420649 rs73565248 T C 2357795
chr11 128420841 rs12272621 G A 2357796
chr11 128420873 rs4245078 T C 2357797
chr11 128420926 rs4245079 C A 2357798
chr11 128420942 rs150138190 T C 2357799
chr11 128420981 rs541019560 ACACACCCTTTAGAAAAGAAAAG A 2357800
chr11 128421078 rs189009644 C A,G,T 2357801
chr11 128421083 rs12417306 C T 2357802
chr11 128421175 rs4262739 G A 2357803
chr11 128421199 rs138616191 G C 2357804
chr11 128421200 rs79945707 A C 2357805
chr11 128421266 rs185574428 A G 2357806
chr11 128421280 rs189411166 A G 2357807
chr11 128421378 rs143608769 T C 2357808
chr11 128421384 rs559121625 A C 2357809
chr11 128421391 rs181004202 T C 2357810
chr11 128421409 rs185607313 A T 2357811
chr11 128421443 rs188554294 T C 2357812
chr11 128421586 rs4245080 A G 2357813
chr11 128421940 rs11221347 G A 2357814
chr11 128421961 rs115611796 G A,C 2357815
chr11 128422034 rs370032107 T C 2357816
chr11 128422120 rs191586487 A G 2357817
Genes possibly regulated by ZBTB33[chr11:128420047-128422148]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr11:128420047-128422148]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results