EnhancerDB
  1. Home
  2. TFBS
  3. TEF1[chr11:128420910-128421164]
Chromosome characteristics of TEF1[chr11:128420910-128421164]
Back to top
Enhancers possibly regulated by TEF1[chr11:128420910-128421164]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 128412401 128441450 enh2106
Blood (T-cell) Esophagus Bone (Osteoblast) Lung Blood (OCI-LY7) Blood (GM12878) Stomach Placenta Thyroid Uterus Peripheral Blood (MM.1S) Blood (Karpas-422) Muscle (Myoblast) Breast Muscle (Myotube) Neural Stem Cells (H9) Thymus Heart
chr11 128420960 128421096 vista12097
VISTA
SNP sites on TEF1[chr11:128420910-128421164]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 128420926 rs4245079 C A 2357798
chr11 128420942 rs150138190 T C 2357799
chr11 128420981 rs541019560 ACACACCCTTTAGAAAAGAAAAG A 2357800
chr11 128421078 rs189009644 C A,G,T 2357801
chr11 128421083 rs12417306 C T 2357802
Genes possibly regulated by TEF1[chr11:128420910-128421164]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TEF1[chr11:128420910-128421164]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results