EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr14:68937370-68943898]
Chromosome characteristics of ZBTB33[chr14:68937370-68943898]
Back to top
Enhancers possibly regulated by ZBTB33[chr14:68937370-68943898]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 68939545 68944315 enh62414
Prostate (PC-3) Epithelial (MCF-7) Esophagus Uterus Stomach
chr14 68923558 68938132 enh30990
Brain (SK-N-MC) Liver Astrocyte Colon (HCT116) Pancreas Uterus Stomach Epithelial (MCF-7) Skin (Keratinocyte) Thyroid Pancreas (Panc1) Neural Stem Cells (H9) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Lung (PC-9) Breast Muscle (Myoblast) Spleen Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673)
chr14 68943032 68943562 vista18229
VISTA
SNP sites on ZBTB33[chr14:68937370-68943898]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 68937585 rs74059320 T G 3625532
chr14 68937742 rs149572124 G T 3625533
chr14 68937838 rs73278375 T C 3625534
chr14 68937933 rs74059321 G A,C 3625535
chr14 68938192 rs551393871 C T 3625536
chr14 68938346 rs2717218 T A 3625537
chr14 68938359 rs111758115 G A 3625538
chr14 68938364 rs2525507 A G 3625539
chr14 68938391 rs185396963 C T 3625540
chr14 68938392 rs578029956 G A 3625541
chr14 68938410 rs35932002 C CA 3625542
chr14 68938424 rs74059322 A G 3625543
chr14 68938544 rs143752615 G T 3625544
chr14 68938874 rs117190791 G A 3625545
chr14 68939072 rs139727656 G A 3625546
chr14 68939157 rs3784126 C G,T 3625547
chr14 68939207 rs3784127 G A 3625548
chr14 68939360 rs142974087 T C 3625549
chr14 68939394 rs114762561 T C 3625550
chr14 68939416 rs555285265 A G,T 3625551
chr14 68939466 rs151125300 C T 3625552
chr14 68939555 rs140056770 C T 3625553
chr14 68939661 rs77904294 T C 3625554
chr14 68939708 rs115317632 C T 3625555
chr14 68939764 rs77215733 C T 3625556
chr14 68939911 rs78693287 C T 3625557
chr14 68939915 rs115117301 C G 3625558
chr14 68939949 rs144923187 G A 3625559
chr14 68940092 rs10142629 C A,T 3625560
chr14 68940193 rs559178667 G C 3625561
chr14 68940212 rs181126389 C T 3625562
chr14 68940259 rs1004062240 C CT 3625563
chr14 68940259 rs142254997 C CT 3625564
chr14 68940326 rs200362055 GA G 3625565
chr14 68940404 rs560734260 A G 3625566
chr14 68940882 rs534151797 A T 3625567
chr14 68940938 rs10782456 A C 3625568
chr14 68940955 rs35896235 A ATT 3625569
chr14 68940955 rs386381665 A ATT 3625570
chr14 68940955 rs397809880 A ATT 3625571
chr14 68940955 rs542152385 A ATT 3625572
chr14 68941040 rs76844695 C A 3625573
chr14 68941043 rs187640254 C T 3625574
chr14 68941046 rs72727481 A G 3625575
chr14 68941124 rs78295584 G C,T 3625576
chr14 68941136 rs116015668 A G 3625577
chr14 68941165 rs532108735 ATTC A 3625578
chr14 68941183 rs190904254 G A 3625579
chr14 68941237 rs10146058 G C 3625580
chr14 68941269 rs531570608 GGTAAA G 3625581
chr14 68941325 rs8012967 G T 3625582
chr14 68941615 rs8013198 C A 3625583
chr14 68941649 rs527728014 G A 3625584
chr14 68941669 rs184660153 A G 3625585
chr14 68941677 rs571193702 C T 3625586
chr14 68941989 rs10138140 T C,G 3625587
chr14 68941997 rs192980353 C T 3625588
chr14 68942069 rs78618613 T C 3625589
chr14 68942191 rs113065547 A G 3625590
chr14 68942376 rs185034226 T G 3625591
chr14 68942397 rs10149340 A G 3625592
chr14 68942408 rs189019884 T A 3625593
chr14 68942409 rs10149349 A T 3625594
chr14 68942709 rs138845273 G A 3625595
chr14 68942762 rs138305626 GAA G 3625596
chr14 68942762 rs765333919 GAA G 3625597
chr14 68942762 rs869045520 GAA G 3625598
chr14 68942873 rs73278387 C T 3625599
chr14 68943063 rs552296312 G GAATGCTGATTAGTTCCATCACT 3625600
chr14 68943137 rs142031268 G A 3625601
chr14 68943161 rs28376370 C T 3625602
chr14 68943381 rs541422345 CAG C 3625603
chr14 68943414 rs61257313 A C 3625604
chr14 68943422 rs146346614 G A,C 3625605
chr14 68943496 rs572213126 A G,T 3625606
chr14 68943512 rs189486090 T A 3625607
chr14 68943533 rs180846493 G T 3625608
chr14 68943643 rs578126110 GC G 3625609
Genes possibly regulated by ZBTB33[chr14:68937370-68943898]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr14:68937370-68943898]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results