Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 99394009 rs77883070 A G 4221759
chr15 99394100 rs59057074 TTGATTGAGTGCATATTGTGGAC T 4221760
chr15 99394219 rs539148112 T C 4221761

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results