EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr15:99394098-99394568]
Chromosome characteristics of TCF7L2[chr15:99394098-99394568]
Back to top
Enhancers possibly regulated by TCF7L2[chr15:99394098-99394568]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 99392124 99430186 enh16459
Adrenal Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Spleen Liver (HepG2) Prostate (RWPE1) Muscle (A673) Heart
chr15 99394435 99394579 vista21387
VISTA
SNP sites on TCF7L2[chr15:99394098-99394568]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 99394100 rs59057074 TTGATTGAGTGCATATTGTGGAC T 4221760
chr15 99394219 rs539148112 T C 4221761
Genes possibly regulated by TCF7L2[chr15:99394098-99394568]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr15:99394098-99394568]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results