EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr16:11718913-11720285]
Chromosome characteristics of ZNF274[chr16:11718913-11720285]
Back to top
Enhancers possibly regulated by ZNF274[chr16:11718913-11720285]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 11694149 11728755 enh16539
Bone Marrow (K562) Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Blood (OCI-LY7) Lung (A549) Thyroid Peripheral Blood (MM.1S) Thymus Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Spleen Muscle (Myotube) Prostate (RWPE1) Lung Heart
chr16 11718451 11719196 vista21889
VISTA
SNP sites on ZNF274[chr16:11718913-11720285]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 11718972 rs143227890 T C 4320403
chr16 11719050 rs13336957 G A,C 4320404
chr16 11719121 rs112259926 C CT 4320405
chr16 11719121 rs376508957 C CT 4320406
chr16 11719121 rs555931480 C CT 4320407
chr16 11719150 rs553906871 G A 4320408
chr16 11719170 rs113750852 A G 4320409
chr16 11719254 rs564796310 G A 4320410
chr16 11719371 rs144465260 C T 4320411
chr16 11719410 rs113653504 T C 4320412
chr16 11719459 rs148402492 A G 4320413
chr16 11719562 rs72781053 G C 4320414
chr16 11719598 rs182056610 C T 4320415
chr16 11719753 rs151006689 A G 4320416
chr16 11719754 rs74563377 C T 4320417
chr16 11719755 rs575159476 G A 4320418
chr16 11719767 rs186212216 C T 4320419
chr16 11719781 rs113924152 G T 4320420
chr16 11719891 rs117824720 C T 4320421
chr16 11719931 rs568855835 T C 4320422
chr16 11719987 rs116730322 C G 4320423
chr16 11720049 rs532164623 A C 4320424
chr16 11720066 rs12446552 T C 4320425
chr16 11720113 rs576361223 C A 4320426
chr16 11720130 rs144433062 G A 4320427
chr16 11720147 rs185252999 G A 4320428
chr16 11720186 rs116413147 C T 4320429
chr16 11720188 rs539816467 C A 4320430
chr16 11720264 rs559646770 A ATCTCAGCTCACTGCAACCTCTGCC 4320431
Genes possibly regulated by ZNF274[chr16:11718913-11720285]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr16:11718913-11720285]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results