EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr16:85368705-85369221]
Chromosome characteristics of TCF7L2[chr16:85368705-85369221]
Back to top
Enhancers possibly regulated by TCF7L2[chr16:85368705-85369221]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85333005 85372015 enh16866
Bone Marrow (K562) Brain (SK-N-MC) Liver Colon (HCT116) Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Thyroid Pancreas (Panc1) Neural Stem Cells (H9) Thymus Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
chr16 85368480 85368758 vista23294
VISTA
SNP sites on TCF7L2[chr16:85368705-85369221]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85368706 rs59764687 C T 4621011
chr16 85368781 rs185953414 G A,C 4621012
chr16 85368844 rs8061198 C T 4621013
chr16 85368974 rs8061803 G A 4621014
chr16 85368984 rs4783167 A G 4621015
chr16 85369011 rs527345060 T C 4621016
chr16 85369023 rs142465712 A T 4621017
chr16 85369058 rs542531878 TGCAGGAGGCGGAGGCCGTGCTGTGCGGGCTG T 4621018
chr16 85369067 rs8061671 C T 4621019
chr16 85369074 rs114607597 C T 4621020
chr16 85369099 rs183306404 G A 4621021
chr16 85369155 rs376820734 G A 4621022
Genes possibly regulated by TCF7L2[chr16:85368705-85369221]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr16:85368705-85369221]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results