EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr16:85623294-85623942]
Chromosome characteristics of TCF7L2[chr16:85623294-85623942]
Back to top
Enhancers possibly regulated by TCF7L2[chr16:85623294-85623942]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85541745 85623813 enh16872
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Kidney Stomach Brain (SK-N-SH) Bone (Osteoblast) Blood (OCI-LY7) Lung (A549) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
chr16 85623714 85624085 vista23333
VISTA
SNP sites on TCF7L2[chr16:85623294-85623942]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85623345 rs147323823 G GGAT 4625879
chr16 85623402 rs538166049 T G 4625880
chr16 85623408 rs375014525 GTGTGTGAATGTGAGTGTGAATA G 4625881
chr16 85623408 rs568759231 GTGTGTGAATGTGAGTGTGAATA G 4625882
chr16 85623421 rs7189688 A T 4625883
chr16 85623429 rs7201644 T C 4625884
chr16 85623430 rs554003723 A G 4625885
chr16 85623502 rs186965102 G A 4625886
chr16 85623515 rs191814101 C T 4625887
chr16 85623519 rs376859904 GTGAT G 4625888
chr16 85623554 rs567064422 TG T 4625889
chr16 85623562 rs575218703 TGA T 4625890
chr16 85623619 rs557749344 GTGAA G 4625891
chr16 85623655 rs202158480 CTG C 4625892
chr16 85623655 rs61150792 CTG C 4625893
chr16 85623675 rs548808463 CTGAT C 4625894
chr16 85623702 rs139283090 GTGAT G 4625895
chr16 85623786 rs115863853 A G 4625896
chr16 85623790 rs577615912 CACTG C 4625897
chr16 85623800 rs145034493 ATG A 4625898
chr16 85623800 rs769466861 ATG A 4625899
chr16 85623806 rs571495364 G A 4625900
chr16 85623838 rs535974670 G A 4625901
chr16 85623878 rs114582332 T C 4625902
chr16 85623890 rs111172015 G A 4625903
chr16 85623901 rs111067812 T C 4625904
chr16 85623906 rs151318324 G C 4625905
chr16 85623928 rs562695623 ATGTG A 4625906
Genes possibly regulated by TCF7L2[chr16:85623294-85623942]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr16:85623294-85623942]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results