EnhancerDB

Chrom	Start	End	Enhancer ID	Tissues that enhancer appears	More
chr16	89410245	89452355	enh16906	Bone Marrow (K562) Liver Astrocyte Colon (HCT116) Embryonic Stem Cell Line (H1-hESC) Pancreas Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673) Heart
chr16	89410388	89410772	vista23565	VISTA

Chrom	Position	dbSNP ID	Reference Allele	Alternative Allele	id	More
chr16	89410249	rs74033775	G	A	4675234
chr16	89410549	rs191578542	G	A	4675235
chr16	89410569	rs528537940	G	A,C	4675236
chr16	89410991	rs145447517	GATA	G	4675237
chr16	89411010	rs3096296	C	A	4675238
chr16	89411134	rs199567923	CGAGGGCACGGGAGCACAGCG	C	4675239
chr16	89411134	rs375117859	CGAGGGCACGGGAGCACAGCG	C	4675240
chr16	89411173	rs111767678	C	T	4675241
chr16	89411186	rs374297187	G	A	4675242
chr16	89411233	rs117348982	G	A	4675243
chr16	89411295	rs3102383	G	A	4675244
chr16	89411412	rs114652429	G	A	4675245

Blank TSI value indicates lack of sufficient expression for calculation
Chrom	Start	End	Strand	Gene Name	Ensembl ID	TSS	TSI of Normal tissues	TSI of Cancer tissues	Distance to TFBS	id	More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom	Start	End	strand	miRNA Name	miRBase ID	TSS	TSI of Normal tissues	TSI of Cancer tissues	Distance to TFBS	id	More

No results