EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:773600-774144]
Chromosome characteristics of ZNF274[chr17:773600-774144]
Back to top
Enhancers possibly regulated by ZNF274[chr17:773600-774144]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 769365 796155 enh4193
Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Uterus Epithelial (MCF-7) Stomach Skin (Keratinocyte) Ovary Bone (Osteoblast) Blood (OCI-LY7) Thyroid Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Esophagus Placenta Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Heart
chr17 773525 773702 vista23625
VISTA
SNP sites on ZNF274[chr17:773600-774144]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 773635 rs531980569 GATCAGAGTGAGGCGGCCTAAGGGAGC G 4686300
chr17 773648 rs77132143 C T 4686301
chr17 773865 rs550112382 C T 4686302
chr17 773948 rs77745940 T C 4686303
chr17 773995 rs150178888 G C 4686304
chr17 774082 rs79503588 C T 4686305
chr17 774136 rs547460416 T C 4686306
chr17 774137 rs560420338 C G,T 4686307
chr17 774138 rs186167292 G A 4686308
Genes possibly regulated by ZNF274[chr17:773600-774144]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:773600-774144]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results