Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 60253851 60272895 enh17275
chr17 60255991 60256253 vista25428

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 60255884 rs7207144 C T 4972004
chr17 60255955 rs114257323 G A 4972005
chr17 60255958 rs192337909 G A 4972006
chr17 60256042 rs540603648 T C 4972007
chr17 60256208 rs7211390 A G 4972008
chr17 60256228 rs555641285 A G 4972009
chr17 60256384 rs543187751 AACCACATCCTTGCCCCCGCCAAT A 4972010
chr17 60256434 rs187863233 C A 4972011
chr17 60256510 rs78957045 C G 4972012
chr17 60256590 rs116905407 C T 4972013
chr17 60256715 rs3935438 G A 4972014

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results