EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr19:1171840-1174880]
Chromosome characteristics of TCF7L2[chr19:1171840-1174880]
Back to top
Enhancers possibly regulated by TCF7L2[chr19:1171840-1174880]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 1159608 1173238 enh17838
Bone Marrow (K562) Cervix (HeLa-S3) Prostate (RWPE1) Esophagus Bone (Osteoblast) Placenta Thyroid Uterus Stomach
chr19 1174025 1184042 enh17839
Skin (Keratinocyte) Prostate (PC-3) Large Intestine Esophagus Stomach Placenta Thyroid Lung (PC-9) Pancreas Epithelial (MCF-7)
chr19 1171933 1172315 vista28144
VISTA
chr19 1172839 1173266 vista28145
VISTA
SNP sites on TCF7L2[chr19:1171840-1174880]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 1172032 rs192327611 C T 5372749
chr19 1172184 rs117257689 G A 5372750
chr19 1172216 rs367787649 A T 5372751
chr19 1172332 rs111374841 G C,T 5372752
chr19 1172349 rs374072948 G A,T 5372753
chr19 1172419 rs73509355 G A 5372754
chr19 1172472 rs572207061 G A 5372755
chr19 1172513 rs113069638 C T 5372756
chr19 1172570 rs1433130 G A 5372757
chr19 1172639 rs76224134 G T 5372758
chr19 1172708 rs577453753 C T 5372759
chr19 1172762 rs538587967 A G 5372760
chr19 1172784 rs556889622 C A 5372761
chr19 1172801 rs574385072 C A 5372762
chr19 1172984 rs10775584 A T 5372763
chr19 1172989 rs533145186 AT A 5372764
chr19 1172989 rs71335343 AT A 5372765
chr19 1172989 rs869281342 AT A 5372766
chr19 1173279 rs148800518 ACTCGGGCCAT A 5372767
chr19 1173279 rs374074231 ACTCGGGCCAT A 5372768
chr19 1173313 rs561607417 G A 5372769
chr19 1173554 rs55961439 A G 5372770
chr19 1173824 rs188011428 G A 5372771
chr19 1173826 rs111467467 G T 5372772
chr19 1173827 rs180784229 G A 5372773
chr19 1173840 rs372096825 C T 5372774
chr19 1173866 rs557422584 G A 5372775
chr19 1173893 rs117830785 A G 5372776
chr19 1174016 rs568596329 G GGCGGGGGTCCCGCCGCGCTCGCCCCCGCCCCA 5372777
chr19 1174022 rs555650715 G A 5372778
chr19 1174313 rs564527169 C G 5372779
chr19 1174316 rs531966652 G T 5372780
chr19 1174317 rs201384443 C CG 5372781
chr19 1174349 rs550360871 A C 5372782
chr19 1174401 rs376386875 C T 5372783
chr19 1174407 rs140554381 C G,T 5372784
chr19 1174414 rs873073 G A,C,T 5372785
chr19 1174553 rs188506748 C A 5372786
chr19 1174602 rs873074 C T 5372787
chr19 1174612 rs79563012 C T 5372788
chr19 1174801 rs7507718 G A 5372789
chr19 1174825 rs186542856 C A 5372790
chr19 1174857 rs117462734 G A 5372791
Genes possibly regulated by TCF7L2[chr19:1171840-1174880]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 1107636 1174282 - SBNO2 ENSG00000064932.11 1174282 0.75 1.0 598 16735
Expression level of Genes
Back to top
miRNAs possibly regulated by TCF7L2[chr19:1171840-1174880]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results