EnhancerDB

Chrom	Start	End	Enhancer ID	Tissues that enhancer appears
chr19	1159608	1173238	enh17838	Bone Marrow (K562) Cervix (HeLa-S3) Prostate (RWPE1) Esophagus Bone (Osteoblast) Placenta Thyroid Uterus Stomach
chr19	1174025	1184042	enh17839	Skin (Keratinocyte) Prostate (PC-3) Large Intestine Esophagus Stomach Placenta Thyroid Lung (PC-9) Pancreas Epithelial (MCF-7)
chr19	1172839	1173266	vista28145	VISTA

Chrom	Position	dbSNP ID	Reference Allele	Alternative Allele	id
chr19	1172984	rs10775584	A	T	5372763
chr19	1172989	rs533145186	AT	A	5372764
chr19	1172989	rs71335343	AT	A	5372765
chr19	1172989	rs869281342	AT	A	5372766
chr19	1173279	rs148800518	ACTCGGGCCAT	A	5372767
chr19	1173279	rs374074231	ACTCGGGCCAT	A	5372768
chr19	1173313	rs561607417	G	A	5372769
chr19	1173554	rs55961439	A	G	5372770
chr19	1173824	rs188011428	G	A	5372771
chr19	1173826	rs111467467	G	T	5372772
chr19	1173827	rs180784229	G	A	5372773
chr19	1173840	rs372096825	C	T	5372774
chr19	1173866	rs557422584	G	A	5372775
chr19	1173893	rs117830785	A	G	5372776
chr19	1174016	rs568596329	G	GGCGGGGGTCCCGCCGCGCTCGCCCCCGCCCCA	5372777
chr19	1174022	rs555650715	G	A	5372778
chr19	1174313	rs564527169	C	G	5372779
chr19	1174316	rs531966652	G	T	5372780
chr19	1174317	rs201384443	C	CG	5372781
chr19	1174349	rs550360871	A	C	5372782
chr19	1174401	rs376386875	C	T	5372783
chr19	1174407	rs140554381	C	G,T	5372784
chr19	1174414	rs873073	G	A,C,T	5372785
chr19	1174553	rs188506748	C	A	5372786
chr19	1174602	rs873074	C	T	5372787
chr19	1174612	rs79563012	C	T	5372788
chr19	1174801	rs7507718	G	A	5372789

Blank TSI value indicates lack of sufficient expression for calculation
Chrom	Start	End	Strand	Gene Name	Ensembl ID	TSS	TSI of Normal tissues	TSI of Cancer tissues	Distance to TFBS	id	More
chr19	1107636	1174282	-	SBNO2	ENSG00000064932.11	1174282	0.75	1.0	536	16735

Blank TSI value indicates lack of sufficient expression for calculation
Chrom	Start	End	strand	miRNA Name	miRBase ID	TSS	TSI of Normal tissues	TSI of Cancer tissues	Distance to TFBS	id	More

No results