Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 1159608 1173238 enh17838
chr19 1174025 1184042 enh17839
chr19 1172839 1173266 vista28145

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 1173279 rs148800518 ACTCGGGCCAT A 5372767
chr19 1173279 rs374074231 ACTCGGGCCAT A 5372768
chr19 1173313 rs561607417 G A 5372769
chr19 1173554 rs55961439 A G 5372770
chr19 1173824 rs188011428 G A 5372771
chr19 1173826 rs111467467 G T 5372772
chr19 1173827 rs180784229 G A 5372773
chr19 1173840 rs372096825 C T 5372774
chr19 1173866 rs557422584 G A 5372775
chr19 1173893 rs117830785 A G 5372776
chr19 1174016 rs568596329 G GGCGGGGGTCCCGCCGCGCTCGCCCCCGCCCCA 5372777
chr19 1174022 rs555650715 G A 5372778
chr19 1174313 rs564527169 C G 5372779
chr19 1174316 rs531966652 G T 5372780
chr19 1174317 rs201384443 C CG 5372781
chr19 1174349 rs550360871 A C 5372782
chr19 1174401 rs376386875 C T 5372783
chr19 1174407 rs140554381 C G,T 5372784
chr19 1174414 rs873073 G A,C,T 5372785
chr19 1174553 rs188506748 C A 5372786

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 1107636 1174282 - SBNO2 ENSG00000064932.11 1174282 0.75 1.0 281 16735


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results