EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr19:2170173-2172381]
Chromosome characteristics of ZNF274[chr19:2170173-2172381]
Back to top
Enhancers possibly regulated by ZNF274[chr19:2170173-2172381]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 2165405 2178635 enh32873
Bone Marrow (K562) Prostate (PC-3) Liver (HepG2) Large Intestine Esophagus Astrocyte Liver Bone (Osteoblast) Stomach Muscle (A673) Colon (HCT116) Thyroid Pancreas Blood (T-cell) Heart
chr19 2171377 2171588 vista28206
VISTA
chr19 2171641 2172019 vista28207
VISTA
SNP sites on ZNF274[chr19:2170173-2172381]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 2170183 rs553600673 A G 5381939
chr19 2170205 rs4807208 A C 5381940
chr19 2170291 rs538594173 TGCCCCTGGTGTGGTTGGGAG T 5381941
chr19 2170304 rs75397174 G A 5381942
chr19 2170314 rs117473937 G A 5381943
chr19 2170350 rs114496158 A C 5381944
chr19 2170377 rs542717120 G A 5381945
chr19 2170409 rs138885746 G A,C 5381946
chr19 2170436 rs531526648 G A 5381947
chr19 2170455 rs186378371 G A 5381948
chr19 2170528 rs145677294 G A 5381949
chr19 2170550 rs116595981 C A 5381950
chr19 2170693 rs114187696 C T 5381951
chr19 2170746 rs563909672 G T 5381952
chr19 2170764 rs2108524 T C,G 5381953
chr19 2170868 rs12983357 G A,C 5381954
chr19 2170873 rs183481876 G A 5381955
chr19 2170954 rs12986413 A T 5381956
chr19 2171024 rs188821934 C T 5381957
chr19 2171106 rs142715093 C T 5381958
chr19 2171229 rs545856612 G A 5381959
chr19 2171254 rs368778659 C T 5381960
chr19 2171260 rs117809164 G T 5381961
chr19 2171360 rs148308930 T G 5381962
chr19 2171490 rs1015670 G A 5381963
chr19 2171570 rs150805480 G C,T 5381964
chr19 2171620 rs190860079 C T 5381965
chr19 2171685 rs80086439 T G 5381966
chr19 2171750 rs545066203 C T 5381967
chr19 2171762 rs548943482 TC T 5381968
chr19 2171825 rs73514432 C G,T 5381969
chr19 2171871 rs139132024 C T 5381970
chr19 2171876 rs117811814 C T 5381971
chr19 2171985 rs539438223 G A,T 5381972
chr19 2171995 rs145250472 C T 5381973
chr19 2172154 rs376083037 C G 5381974
chr19 2172266 rs147156051 G T 5381975
chr19 2172355 rs184863515 A G,T 5381976
chr19 2172372 rs542052532 C T 5381977
chr19 2172378 rs12978179 T C 5381978
Genes possibly regulated by ZNF274[chr19:2170173-2172381]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr19:2170173-2172381]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results