Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 2489362 rs553830828 TCGGGCACTGCGCCAGGGCC T 5384738
chr19 2489381 rs540484738 C T 5384739
chr19 2489423 rs186928258 C T 5384740
chr19 2489445 rs147785722 T C 5384741
chr19 2489485 rs139580022 C T 5384742
chr19 2489501 rs117513125 T C 5384743
chr19 2489532 rs12985828 G A 5384744
chr19 2489541 rs534990505 T G 5384745
chr19 2489560 rs75603520 C G 5384746
chr19 2489650 rs79746087 T C 5384747
chr19 2489717 rs114419133 C T 5384748
chr19 2489764 rs76844220 G A,C,T 5384749
chr19 2489781 rs144884636 C T 5384750
chr19 2489791 rs540572582 T C 5384751
chr19 2490005 rs79884579 C T 5384752
chr19 2490114 rs577967193 CTTTTTT C 5384753
chr19 2490114 rs759483406 CTTTTTT C 5384754

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results