Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 187403805 187413855 enh19063
chr2 187409105 187409391 vista34041

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 187409119 rs115895004 A G 6241830
chr2 187409293 rs116335643 C T 6241831
chr2 187409354 rs13407066 A G 6241832
chr2 187409453 rs59532865 G A 6241833
chr2 187409470 rs572361025 CAAATTAAAAGTTGTTTCCTACTTGT C 6241834

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results