EnhancerDB
  1. Home
  2. TFBS
  3. MAX[chr6:36628607-36628984]
Chromosome characteristics of MAX[chr6:36628607-36628984]
Back to top
Enhancers possibly regulated by MAX[chr6:36628607-36628984]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 36614945 36639164 enh9086
Astrocyte Colon (HCT116) Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Stomach Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Blood (OCI-LY7) Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673)
chr6 36628616 36629003 vista51755
VISTA
SNP sites on MAX[chr6:36628607-36628984]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 36628672 rs6926780 C T 8995079
chr6 36628712 rs112608888 C G 8995080
chr6 36628722 rs535086865 ACTC A 8995081
chr6 36628728 rs544215381 TCCAGGTCACACCGCCTGAGGTCACACCGTCTGGGCCCCAGCC T 8995082
chr6 36628953 rs9462210 G A 8995083
Genes possibly regulated by MAX[chr6:36628607-36628984]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by MAX[chr6:36628607-36628984]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results