EnhancerDB
  1. Home
  2. TFBS
  3. FOSL2[chr19:5961181-5961192]
Chromosome characteristics of FOSL2[chr19:5961181-5961192]
Back to top
Enhancers possibly regulated by FOSL2[chr19:5961181-5961192]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 5941853 5970935 enh4982
Bone Marrow (K562) Liver Astrocyte Colon (HCT116) Adrenal Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on FOSL2[chr19:5961181-5961192]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 5961182 rs542245185 CGGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCGA C 5411673
chr19 5961183 rs377459486 G A 5411674
Genes possibly regulated by FOSL2[chr19:5961181-5961192]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by FOSL2[chr19:5961181-5961192]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results