EnhancerDB
  1. Home
  2. TFBS
  3. LEF1[chr19:13956858-13956873]
Chromosome characteristics of LEF1[chr19:13956858-13956873]
Back to top
Enhancers possibly regulated by LEF1[chr19:13956858-13956873]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 13941465 13967615 enh5016
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Peripheral Blood (MM.1S) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on LEF1[chr19:13956858-13956873]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 13956870 rs138041782 A ATTTGTTTTGTTTTGT 5452059
chr19 13956870 rs61512280 A ATTTGTTTTGTTTTGT,ATTTGTTTTGTTTTGTTTTGTTTTGT 5452060
Genes possibly regulated by LEF1[chr19:13956858-13956873]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by LEF1[chr19:13956858-13956873]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 13947140 13947161 - hsa-miR-24-2-5p MIMAT0004497 13953731 0.639089 0.668807 3127 829
chr19 13947261 13947281 - hsa-miR-27a-3p MIMAT0000084 13953731 0.74941 0.0 3127 831
chr19 13947409 13947429 - hsa-miR-23a-3p MIMAT0000078 13953731 0.768964 0.0 3127 833
Expression level of miRNAs
Back to top