EnhancerDB
  1. Home
  2. TFBS
  3. RARA[chr12:53267289-53267307]
Chromosome characteristics of RARA[chr12:53267289-53267307]
Back to top
Enhancers possibly regulated by RARA[chr12:53267289-53267307]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 53249369 53285465 enh14733
Bone Marrow (K562) Astrocyte Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Bone (Osteoblast) Lung (A549) Thyroid Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673)
SNP sites on RARA[chr12:53267289-53267307]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 53267293 rs371691578 G GTTTATCTAGCTATCCCCATTTTA 2642535
chr12 53267299 rs2638519 A G 2642536
Genes possibly regulated by RARA[chr12:53267289-53267307]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RARA[chr12:53267289-53267307]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results