EnhancerDB
  1. Home
  2. TFBS
  3. GATA1[chr12:96035031-96035039]
Chromosome characteristics of GATA1[chr12:96035031-96035039]
Back to top
Enhancers possibly regulated by GATA1[chr12:96035031-96035039]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 96013625 96050402 enh14919
Liver Astrocyte Pancreas Uterus Epithelial (MCF-7) Stomach Skin (Keratinocyte) Ovary Bone (Osteoblast) Pancreas (Panc1) Neural Stem Cells (H9) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Spleen Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673) Heart
SNP sites on GATA1[chr12:96035031-96035039]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 96035034 rs71087986 C CCTAT,CCTATCTATCTATCTATCTATCTAT 2828505
chr12 96035037 rs530666043 A ATCTATCTATCTTTCTT 2828506
Genes possibly regulated by GATA1[chr12:96035031-96035039]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by GATA1[chr12:96035031-96035039]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results